SF3B14 (SF3B6) (NM_016047) Human 3' UTR Clone

CAT#: SC202065

3' UTR clone of splicing factor 3B 14 kDa subunit (SF3B14) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name SF3B14 (SF3B6) (NM_016047) Human 3' UTR Clone
Vector pMirTarget
Synonyms CGI-110; HSPC175; Ht006; P14; SAP14; SAP14a; SF3B14; SF3B14a
ACCN NM_016047
Insert Size 206 bp
Sequence Data
>SC202065 3’UTR clone of NM_016047
The sequence shown below is from the reference sequence of NM_016047. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TATGGCATCAACACAGATCCACCAAAATAAATGTTTTCTACATTTTCATTTGGACTAAATCCCACGAAT
GACAACTACCACCTTTTTTTCCTTTTTAATTAATACTAAATATTGTGATTTCTTATTTGAGGTTCAAAA
TGACCTGCTTGAAACTTTGATACATATTGGAATACATTATGTTAATAAACTTGTAGCTTTTTGTGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_016047.4
Synonyms CGI-110; HSPC175; Ht006; P14; SAP14; SAP14a; SF3B14; SF3B14a
Summary This gene encodes a 14 kDa protein subunit of the splicing factor 3b complex. Splicing factor 3b associates with both the U2 and U11/U12 small nuclear ribonucleoprotein complexes (U2 snRNP) of spliceosomes. This 14 kDa protein interacts directly with subunit 1 of the splicing factor 3b complex. This 14 kDa protein also interacts directly with the adenosine that carries out the first transesterification step of splicing at the pre-mRNA branch site. [provided by RefSeq, Jul 2008]
Locus ID 51639
MW 7.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...