CEP290 (NM_025114) Human 3' UTR Clone

CAT#: SC202023

3' UTR clone of centrosomal protein 290kDa (CEP290) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name CEP290 (NM_025114) Human 3' UTR Clone
Vector pMirTarget
Synonyms 3H11Ag; BBS14; CT87; JBTS5; LCA10; MKS4; NPHP6; POC3; rd16; SLSN6
ACCN NM_025114
Insert Size 198 bp
Sequence Data
>SC202023 3’UTR clone of NM_025114
The sequence shown below is from the reference sequence of NM_025114. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAAAGTCCTGTTAATTTCCCCATTTACTAAAGGTCACCTATAAACTTTGTTTCATTTAACTATTTATTA
ACTTTATAAGTTAAATATACTTGGAAATAAGCAGTTCTCCGAACTGTAGTATTTCCTTCTCACTACCTT
GTACCTTTATACTTAGATTGGAATTCTTAATAAATAAAATTATATGAAATTTTCAACTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_025114.4
Synonyms 3H11Ag; BBS14; CT87; JBTS5; LCA10; MKS4; NPHP6; POC3; rd16; SLSN6
Summary This gene encodes a protein with 13 putative coiled-coil domains, a region with homology to SMC chromosome segregation ATPases, six KID motifs, three tropomyosin homology domains and an ATP/GTP binding site motif A. The protein is localized to the centrosome and cilia and has sites for N-glycosylation, tyrosine sulfation, phosphorylation, N-myristoylation, and amidation. Mutations in this gene have been associated with Joubert syndrome and nephronophthisis and the presence of antibodies against this protein is associated with several forms of cancer. [provided by RefSeq, Jul 2008]
Locus ID 80184
MW 7.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...