SNRP70 (SNRNP70) (NM_003089) Human 3' UTR Clone

CAT#: SC202009

3' UTR clone of small nuclear ribonucleoprotein 70kDa (U1) (SNRNP70) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name SNRP70 (SNRNP70) (NM_003089) Human 3' UTR Clone
Vector pMirTarget
Synonyms RNPU1Z; RPU1; Snp1; SNRP70; U1-70K; U1AP; U1RNP; U170K
ACCN NM_003089
Insert Size 191 bp
Sequence Data
>SC202009 3’UTR clone of NM_003089
The sequence shown below is from the reference sequence of NM_003089. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGGTATTTGATGGAGGCTGCGCCGGAGTGAAGAGGTCGTCCTCTCCATCTGCTGTGTTTGGACGCGTTC
CTGCCCAGCCCCTTGCTGTCATCCCCTCCCCCAACCTTGGCCACTTGAGTTTGTCCTCCAAGGGTAGGT
GTCTCATTTGTTCTGGCCCCTTGGATTTAAAAATAAAATTAATTTCCTGTTGA
AGCGGACCGACTTACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCC
CAACCTGCCATCACGAGATTTCGATTCCACCGCCGC
Restriction Sites SgfI-RsrII     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003089.6
Synonyms RNPU1Z; RPU1; Snp1; SNRP70; U1-70K; U1AP; U1RNP; U170K
Summary Component of the spliceosomal U1 snRNP, which is essential for recognition of the pre-mRNA 5' splice-site and the subsequent assembly of the spliceosome (PubMed:19325628, PubMed:25555158). SNRNP70 binds to the loop I region of U1-snRNA (PubMed:2467746, PubMed:19325628, PubMed:25555158).[UniProtKB/Swiss-Prot Function]
Locus ID 6625
MW 6.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...