Separase (ESPL1) (NM_012291) Human 3' UTR Clone

CAT#: SC202001

3' UTR clone of extra spindle pole bodies homolog 1 (S. cerevisiae) (ESPL1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Separase (ESPL1) (NM_012291) Human 3' UTR Clone
Vector pMirTarget
Synonyms ESP1; SEPA
ACCN NM_012291
Insert Size 194 bp
Sequence Data
>SC202001 3’UTR clone of NM_012291
The sequence shown below is from the reference sequence of NM_012291. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCCTATGGCTTGCCTGTCTCTCTGCGGTAACCCCATGGAGCTGTCTTATTGATGCTAGAAGCCTCATAA
CTGTTCTACCTCCAAGGTTAGATTTAATCCTTAGGATAACTCTTTTAAAGTGATTTTCCCCAGTGTTTT
ATATGAAACATTTCCTTTTGATTTAACCTCAGTATAATAAAGATACATCATTTAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_012291.5
Synonyms ESP1; SEPA
Summary Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
Locus ID 9700
MW 7.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...