FPR1 (NM_002029) Human 3' UTR Clone

CAT#: SC201992

3' UTR clone of formyl peptide receptor 1 (FPR1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Cited in 4 publications.

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name FPR1 (NM_002029) Human 3' UTR Clone
Vector pMirTarget
Synonyms FMLP; FPR
ACCN NM_002029
Insert Size 199 bp
Sequence Data
>SC201992 3’UTR clone of NM_002029
The sequence shown below is from the reference sequence of NM_002029. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCTGCAGAGGTGGAGTTACAGGCAAAGTGAGGAGGGAGCTGGGGGACACTTTCGAGCTCCCAGCTCCAG
CTTCGTCTCACCTTGAGTTAGGCTGAGCCACAGGCATTTCCTGCTTATTTTAGGATTACCCACTCATCA
GAAAAAAAAAAAAAAGCCTTTGTGTCCCCTGATTTGGGGAGAATAAACAGATATGAGTTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002029.4
Synonyms FMLP; FPR
Summary This gene encodes a G protein-coupled receptor of mammalian phagocytic cells that is a member of the G-protein coupled receptor 1 family. The protein mediates the response of phagocytic cells to invasion of the host by microorganisms and is important in host defense and inflammation.[provided by RefSeq, Jul 2010]
Locus ID 2357
MW 7.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (4)

Documents

Customer Reviews 
Loading...