GGT1 (NM_005265) Human 3' UTR Clone

CAT#: SC201966

3' UTR clone of gamma-glutamyltransferase 1 (GGT1) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name GGT1 (NM_005265) Human 3' UTR Clone
Vector pMirTarget
Synonyms CD224; D22S672; D22S732; GGT; GGT 1; GTG
ACCN NM_005265
Insert Size 196 bp
Sequence Data
>SC201966 3’UTR clone of NM_005265
The sequence shown below is from the reference sequence of NM_005265. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGGAAAGGCGGGGAGCCTGCCGGCTACTGAGTGCTCCAGGAGGACAAGGCTGACAAGCAATCCAGGGAC
AAGATACTCACCAGGACCAGGAAGGGGACTCTGGGGGACCGGCTTCCCCTGTGAGCAGCAGAGCAGCAC
AATAAATGAGGCCACTGTGCCAGGCTCCAGGTGGCCTCCCTGGCCTGTCTCCCCACTC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005265.3
Synonyms CD224; D22S672; D22S732; GGT; GGT 1; GTG
Summary The enzyme encoded by this gene is a type I gamma-glutamyltransferase that catalyzes the transfer of the glutamyl moiety of glutathione to a variety of amino acids and dipeptide acceptors. The enzyme is composed of a heavy chain and a light chain, which are derived from a single precursor protein. It is expressed in tissues involved in absorption and secretion and may contribute to the etiology of diabetes and other metabolic disorders. Multiple alternatively spliced variants have been identified. There are a number of related genes present on chromosomes 20 and 22, and putative pseudogenes for this gene on chromosomes 2, 13, and 22. [provided by RefSeq, Jan 2014]
Locus ID 2678
MW 7.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...