EDF1 (NM_003792) Human 3' UTR Clone

CAT#: SC201952

3' UTR clone of endothelial differentiation-related factor 1 (EDF1) transcript variant alpha for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name EDF1 (NM_003792) Human 3' UTR Clone
Vector pMirTarget
Synonyms CFAP280; EDF-1; MBF1
ACCN NM_003792
Insert Size 195 bp
Sequence Data
>SC201952 3’UTR clone of NM_003792
The sequence shown below is from the reference sequence of NM_003792. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCCATCGAGAAGGGGCCTAGGGCGAAATGAACACAAAGCCTCGAAATCAGTGCGCTCCAGCTGATCTCG
TTCCGCCGGTTCCCCTTGGCCGCCAGTTCCGTTCTCCTCACGGGCCGAACGGAACAAGGGGTCCAGCTT
GCGGGGGACCCTCCCCAGCCCATTCCTGCTGTCAAACAAACAAAACCTTGCAAAGCG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003792.4
Synonyms CFAP280; EDF-1; MBF1
Summary This gene encodes a protein that may regulate endothelial cell differentiation, lipid metabolism, and hormone-induced cardiomyocyte hypertrophy. The encoded protein has also been found to act as a transcriptional coactivator by interconnecting the general transcription factor TATA element-binding protein (TBP) and gene-specific activators. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Locus ID 8721
MW 7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...