RPL39 (NM_001000) Human 3' UTR Clone

CAT#: SC201883

3' UTR clone of ribosomal protein L39 (RPL39) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name RPL39 (NM_001000) Human 3' UTR Clone
Vector pMirTarget
Synonyms L39; RPL39P42; RPL39_23_1806
ACCN NM_001000
Insert Size 186 bp
Sequence Data
>SC201883 3' UTR clone of NM_001000
The sequence shown below is from the reference sequence of NM_001000. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGAGACATTGGAGAAGAACCAAGCTGGGTCTATAAGGAATTGCACATGAGATGGCACACATATTTATGCT
GTCTGAAGGTCACGATCATGTTACCATATCAAGCTGAAAATGTCACCACTATCTGGAGATTTCGACGTGT
TTTCCTCTCTGAATCTGTTATGAACACGTTGGTTGGCTGGATTCAG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001000.2
Synonyms L39; RPL39P42; RPL39_23_1806
Summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the S39E family of ribosomal proteins. It is located in the cytoplasm. In rat, the protein is the smallest, and one of the most basic, proteins of the ribosome. This gene is co-transcribed with the U69 small nucleolar RNA gene, which is located in its second intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Locus ID 6170
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...