AE2 (SLC4A2) (NM_003040) Human 3' UTR Clone

CAT#: SC201864

3' UTR clone of solute carrier family 4 anion exchanger member 2 (erythrocyte membrane protein band 3-like 1) (SLC4A2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name AE2 (SLC4A2) (NM_003040) Human 3' UTR Clone
Vector pMirTarget
Synonyms AE2; BND3L; EPB3L1; HKB3; NBND3
ACCN NM_003040
Insert Size 186 bp
Sequence Data
>SC201864 3’UTR clone of NM_003040
The sequence shown below is from the reference sequence of NM_003040. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGTACAATGAGATGCCCATGCCTGTGTAGCCGCCACCGAGGGACAGCCGAGGGACCGATGGACGAGGG
GACAGGCTGGTGGGATGGGGTTCCCCCTCCCATGCCCCTCCCTCCTTTTTATTTAAGTGAATAATTTAA
AGTCTTCTCCTCCCCCACTGCCCCTGCAGTAAAGTGCTTTGGCCCCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003040.4
Synonyms AE2; BND3L; EPB3L1; HKB3; NBND3
Summary This gene encodes a member of the anion exchanger family of membrane transport proteins. The encoded protein regulates intracellular pH, biliary bicarbonate secretion, and chloride uptake. Reduced expression of this gene may be associated with primary biliary cirrhosis (PBC) in human patients, while differential expression of this gene may be associated with malignant hepatocellular carcinoma, colon and gastric cancers. [provided by RefSeq, Nov 2016]
Locus ID 6522
MW 6.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...