SMRP1 (C9orf24) (NM_032596) Human 3' UTR Clone

CAT#: SC201858

3' UTR clone of chromosome 9 open reading frame 24 (C9orf24) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name SMRP1 (C9orf24) (NM_032596) Human 3' UTR Clone
Vector pMirTarget
Synonyms bA573M23.4; CBE1; NYD-SP22; SMRP1
ACCN NM_032596
Insert Size 193 bp
Sequence Data
>SC201858 3’UTR clone of NM_032596
The sequence shown below is from the reference sequence of NM_032596. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCCGTCATACTACCCATATCCGAACCTTAGATGGGACACAAGTCACTTCAAGAAGTCTGGTGGTCCCCA
GAGAAACAACTATGTTATCCATCCTGAGTTTGTGTCTGAGACCTATCCCGACTATCGTTGCTGGTAGAG
CCTGGGCTTGCTGTGCCAAGGGGGCAGAGCAATAAATAAACTCTTCAACCCCAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_032596.4
Synonyms bA573M23.4; CBE1; NYD-SP22; SMRP1
Summary This gene encodes a nuclear- or perinuclear-localized protein with no predicted domains or similarity to other known proteins. Expression of this gene is induced during the differentiation of bronchial epithelial cells, and the encoded protein may play a role in ciliogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Locus ID 84688
MW 7.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...