Osteocalcin (BGLAP) (NM_199173) Human 3' UTR Clone

CAT#: SC201854

3' UTR clone of bone gamma-carboxyglutamate (gla) protein (BGLAP) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Osteocalcin (BGLAP) (NM_199173) Human 3' UTR Clone
Vector pMirTarget
Synonyms BGP; OC; OCN
ACCN NM_199173
Insert Size 185 bp
Sequence Data
>SC201854 3’UTR clone of NM_199173
The sequence shown below is from the reference sequence of NM_199173. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCCTATCGGCGCTTCTACGGCCCGGTCTAGGGTGTCGCTCTGCTGGCCTGGCCGGCAACCCCAGTTCTG
CTCCTCTCCAGGCACCCTTCTTTCCTCTTCCCCTTGCCCTTGCCCTGACCTCCCAGCCCTATGGATGTG
GGGTCCCCATCATCCCAGCTGCTCCCAAATAAACTCCAGAAGAGGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_199173.6
Synonyms BGP; OC; OCN
Summary This gene encodes a highly abundant bone protein secreted by osteoblasts that regulates bone remodeling and energy metabolism. The encoded protein contains a Gla (gamma carboxyglutamate) domain, which functions in binding to calcium and hydroxyapatite, the mineral component of bone. Serum osteocalcin levels may be negatively correlated with metabolic syndrome. Read-through transcription exists between this gene and the neighboring upstream gene, PMF1 (polyamine-modulated factor 1), but the encoded protein only shows sequence identity with the upstream gene product. [provided by RefSeq, Jun 2015]
Locus ID 632
MW 6.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...