GTF2IRD1 (NM_016328) Human 3' UTR Clone

CAT#: SC201789

3' UTR clone of GTF2I repeat domain containing 1 (GTF2IRD1) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name GTF2IRD1 (NM_016328) Human 3' UTR Clone
Vector pMirTarget
Synonyms BEN; CREAM1; GTF3; hMusTRD1alpha1; MUSTRD1; RBAP2; WBS; WBSCR11; WBSCR12
ACCN NM_016328
Insert Size 202 bp
Sequence Data
>SC201789 3’UTR clone of NM_016328
The sequence shown below is from the reference sequence of NM_016328. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTGCAGCTCCCGGGACCTCTTAATTACTAGACCTCAGTACTGAATCAGGACCTCACTCAGAAAGACTAA
AGGAAATGTAATTTATGTACAAAATGTATATTCGGATATGTATCGATGCCTTTTAGTTTTTCCAATGAT
TTTTACACTATATTCCTGCCACCAAGGCCTTTTTAAATAAGTAAAAAAAGAAAAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_016328.3
Synonyms BEN; CREAM1; GTF3; hMusTRD1alpha1; MUSTRD1; RBAP2; WBS; WBSCR11; WBSCR12
Summary The protein encoded by this gene contains five GTF2I-like repeats and each repeat possesses a potential helix-loop-helix (HLH) motif. It may have the ability to interact with other HLH-proteins and function as a transcription factor or as a positive transcriptional regulator under the control of Retinoblastoma protein. This gene plays a role in craniofacial and cognitive development and mutations have been associated with Williams-Beuren syndrome, a multisystem developmental disorder caused by deletion of multiple genes at 7q11.23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
Locus ID 9569
MW 7.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...