RIP3 (RIPK3) (NM_006871) Human 3' UTR Clone

CAT#: SC201780

3' UTR clone of receptor-interacting serine-threonine kinase 3 (RIPK3) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name RIP3 (RIPK3) (NM_006871) Human 3' UTR Clone
Vector pMirTarget
Synonyms RIP3
ACCN NM_006871
Insert Size 180 bp
Sequence Data
>SC201780 3’UTR clone of NM_006871
The sequence shown below is from the reference sequence of NM_006871. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGGGTTGGTATAATCATAGCGGGAAATAAAGCACCTTCCAAGCTTGCCTCCAAGAGTTACGAGTTAAG
GAAGAGTGCCACCCCTTGAGGCCCCTGACTTCCTTCTAGGGCAGTCTGGCCTGCCCACAAACTGACTTT
GTGACCTGTCCCCCAGGAGTCAATAAACATGATGGAATGCTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006871.4
Synonyms RIP3
Summary The product of this gene is a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases, and contains a C-terminal domain unique from other RIP family members. The encoded protein is predominantly localized to the cytoplasm, and can undergo nucleocytoplasmic shuttling dependent on novel nuclear localization and export signals. It is a component of the tumor necrosis factor (TNF) receptor-I signaling complex, and can induce apoptosis and weakly activate the NF-kappaB transcription factor. [provided by RefSeq, Jul 2008]
Locus ID 11035
MW 6.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...