SLC39A14 (NM_001135154) Human 3' UTR Clone

CAT#: SC201773

3' UTR clone of solute carrier family 39 (zinc transporter) member 14 (SLC39A14) transcript variant 4 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name SLC39A14 (NM_001135154) Human 3' UTR Clone
Vector pMirTarget
Synonyms cig19; HCIN; HMNDYT2; LZT-Hs4; NET34; ZIP14
ACCN NM_001135154
Insert Size 155 bp
Sequence Data
>SC201773 3’UTR clone of NM_001135154
The sequence shown below is from the reference sequence of NM_001135154. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTATCCTGTCTAAGCCTCCCGAGTAACTGAGCCAGCCATGTTTGTTAATAAAAATGGGGACAATACTGT
ATATATATGGTTATATTTTAGCTTTTTCACTTTTCAGTATCTCCTGAGGCTTTTCTCATGTCATTAAAT
ATTTTTCTAATTTAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001135154.3
Synonyms cig19; HCIN; HMNDYT2; LZT-Hs4; NET34; ZIP14
Summary This gene encodes a member of the the SLC39A family of divalent metal transporters that mediates the cellular uptake of manganese, zinc, iron, and cadmium. The encoded protein contains eight transmembrane domains, a histidine-rich motif, and a metalloprotease motif, and is expressed on the plasma membrane and the endocytic vesicle membrane. It is an important transporter of nontransferrin-bound iron and a critical regulator of manganese homeostasis. Naturally occurring mutations in this gene are associated with neurodegeneration with brain iron accumulation and early-onset parkinsonism-dystonia with hypermanganesemia. [provided by RefSeq, May 2017]
Locus ID 23516
MW 5.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...