NGAL (LCN2) (NM_005564) Human 3' UTR Clone

CAT#: SC201739

3' UTR clone of lipocalin 2 (LCN2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name NGAL (LCN2) (NM_005564) Human 3' UTR Clone
Vector pMirTarget
Synonyms 24p3; MSFI; NGAL; p25
ACCN NM_005564
Insert Size 180 bp
Sequence Data
>SC201739 3’UTR clone of NM_005564
The sequence shown below is from the reference sequence of NM_005564. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTCCCAATCGACCAGTGTATCGACGGCTGAGTGCACAGGTGCCGCCAGCTGCCGCACCAGCCCGAACAC
CATTGAGGGAGCTGGGAGACCCTCCCCACAGTGCCACCCATGCAGCTGCTCCCCAGGCCACCCCGCTGA
TGGAGCCCCACCTTGTCTGCTAAATAAACATGTGCCCTCAGG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005564.5
Synonyms 24p3; MSFI; NGAL; p25
Summary This gene encodes a protein that belongs to the lipocalin family. Members of this family transport small hydrophobic molecules such as lipids, steroid hormones and retinoids. The protein encoded by this gene is a neutrophil gelatinase-associated lipocalin and plays a role in innate immunity by limiting bacterial growth as a result of sequestering iron-containing siderophores. The presence of this protein in blood and urine is an early biomarker of acute kidney injury. This protein is thought to be be involved in multiple cellular processes, including maintenance of skin homeostasis, and suppression of invasiveness and metastasis. Mice lacking this gene are more susceptible to bacterial infection than wild type mice. [provided by RefSeq, Sep 2015]
Locus ID 3934
MW 6.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...