STOML2 (NM_013442) Human 3' UTR Clone

CAT#: SC201725

3' UTR clone of stomatin (EPB72)-like 2 (STOML2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name STOML2 (NM_013442) Human 3' UTR Clone
Vector pMirTarget
Synonyms HSPC108; SLP-2
ACCN NM_013442
Insert Size 287 bp
Sequence Data
>SC201725 3’UTR clone of NM_013442
The sequence shown below is from the reference sequence of NM_013442. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGGAACTTGATCGAGTCAAGATGAGTTAGTGGAGCTGGGCTTGGCCAGGGAGTCTGGGAACAAGGAAG
CAGATTTTCCTGATTCTGGCTCTAGCTTCCCTGCCAAGATTTTGGTTTTTATTTTTTTATTTGAACTTT
AGTCGTGTAATAAACTCACCAGTGGCAAACCAGAAACTGTCCTCTTTGATTGGGGAATGAAGTTGGGAA
AGTCACTAGCATTTTCCTTGGATCCAGTCCTGTCAGCATGATGCCTCCATGAATAAGAGTGAACTTCTT
GTAAAGTGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_013442.3
Synonyms HSPC108; SLP-2
Summary Mitochondrial protein that probably regulates the biogenesis and the activity of mitochondria. Stimulates cardiolipin biosynthesis, binds cardiolipin-enriched membranes where it recruits and stabilizes some proteins including prohibitin and may therefore act in the organization of functional microdomains in mitochondrial membranes. Through regulation of the mitochondrial function may play a role into several biological processes including cell migration, cell proliferation, T-cell activation, calcium homeostasis and cellular response to stress. May play a role in calcium homeostasis through negative regulation of calcium efflux from mitochondria. Required for mitochondrial hyperfusion a pro-survival cellular response to stress which results in increased ATP production by mitochondria. May also regulate the organization of functional domains at the plasma membrane and play a role in T-cell activation through association with the T-cell receptor signaling complex and its regulation.[UniProtKB/Swiss-Prot Function]
Locus ID 30968
MW 11
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...