CCHCR1 (NM_001105563) Human 3' UTR Clone

CAT#: SC201719

3' UTR clone of coiled-coil alpha-helical rod protein 1 (CCHCR1) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name CCHCR1 (NM_001105563) Human 3' UTR Clone
Vector pMirTarget
Synonyms C6orf18; HCR; pg8; SBP
ACCN NM_001105563
Insert Size 183 bp
Sequence Data
>SC201719 3’UTR clone of NM_001105563
The sequence shown below is from the reference sequence of NM_001105563. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCCAGCTCCAATCCCCAGATGAGCAGCTAAGCAGCTGACAGTTGGAGGGAAAGCCAGCCTGGGGGCTGG
GAGGATCCTGGAGAAGTGGGTGGGGACAGACCAGCCCTTCCCCATCCTGGGGTTGCCCTGGGGGATACC
AGCTGAGTCTGAATTCTGCTCTAAATAAAGACGACTACAGAAGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001105563.3
Synonyms C6orf18; HCR; pg8; SBP
Summary This gene encodes a protein with five coiled-coil alpha-helical rod domains that is thought to act as a regulator of mRNA metabolism through its interaction with mRNA-decapping protein 4. It localizes to P-bodies, the site of mRNA metabolism, with an N-terminus that is required for this subcellular localization, suggesting it is a P-body component. Naturally occurring mutations in this gene are associated with psoriasis. [provided by RefSeq, May 2017]
Locus ID 54535
MW 6.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...