PCTP L (STARD10) (NM_006645) Human 3' UTR Clone

CAT#: SC201698

3' UTR clone of StAR-related lipid transfer (START) domain containing 10 (STARD10) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name PCTP L (STARD10) (NM_006645) Human 3' UTR Clone
Vector pMirTarget
Synonyms CGI-52; NY-CO-28; PCTP2; SDCCAG28
ACCN NM_006645
Insert Size 198 bp
Sequence Data
>SC201698 3’UTR clone of NM_006645
The sequence shown below is from the reference sequence of NM_006645. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGCAGCGACGACGACACCTCGCTCACCTGAGCGCCGCACCGCTTCAGGGACGGAGACAGGACCGGGCGA
GCCCTGGGGCGGCGGCCGCTCCTGCACTTTCTCCCCTCCCCCACCCGGCACCTGGTGGCACCGGGCCAG
GCCCAGGCGGGTGCTGCAGCCTGGCTGGACAGAGCCCCAATAAACGATCCCACAGCCTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006645.3
Synonyms CGI-52; NY-CO-28; PCTP2; SDCCAG28
Summary May play metabolic roles in sperm maturation or fertilization (By similarity). Phospholipid transfer protein that preferentially selects lipid species containing a palmitoyl or stearoyl chain on the sn-1 and an unsaturated fatty acyl chain (18:1 or 18:2) on the sn-2 position. Able to transfer phosphatidylcholine (PC) and phosphatidyetanolamline (PE) between membranes.[UniProtKB/Swiss-Prot Function]
Locus ID 10809
MW 7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...