Poliovirus Receptor (PVR) (NM_001135770) Human 3' UTR Clone

CAT#: SC201653

3' UTR clone of poliovirus receptor (PVR) transcript variant 4 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Poliovirus Receptor (PVR) (NM_001135770) Human 3' UTR Clone
Vector pMirTarget
Synonyms CD155; HVED; Necl-5; NECL5; PVS; TAGE4
ACCN NM_001135770
Insert Size 195 bp
Sequence Data
>SC201653 3’UTR clone of NM_001135770
The sequence shown below is from the reference sequence of NM_001135770. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGTGAGCATCACCAGAGCTGCCGTAATTGAGCACCTACTACGGGCTCTGTGCTGAGTCCTTCCAGTGTG
CCTCTCACTGAATCCTCACCCCACTGCCATGAGGTTTCCCCCATTTGACTGATGAGGGTGCAGAGCCAG
GGAGCCTTGTTCACTGGTTCATTGATTACATTTACAAATATTATTTACAGAGTGGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001135770.4
Synonyms CD155; HVED; Necl-5; NECL5; PVS; TAGE4
Summary The protein encoded by this gene is a transmembrane glycoprotein belonging to the immunoglobulin superfamily. The external domain mediates cell attachment to the extracellular matrix molecule vitronectin, while its intracellular domain interacts with the dynein light chain Tctex-1/DYNLT1. The gene is specific to the primate lineage, and serves as a cellular receptor for poliovirus in the first step of poliovirus replication. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Locus ID 5817
MW 7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...