CPAMD8 (NM_015692) Human 3' UTR Clone

CAT#: SC201642

3' UTR clone of C3 and PZP-like alpha-2-macroglobulin domain containing 8 (CPAMD8) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name CPAMD8 (NM_015692) Human 3' UTR Clone
Vector pMirTarget
Synonyms ASGD8; K-CAP; VIP
ACCN NM_015692
Insert Size 187 bp
Sequence Data
>SC201642 3’UTR clone of NM_015692
The sequence shown below is from the reference sequence of NM_015692. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TGGATGTCAAACACCTGCACCTTGAGATAATCCTACAACCACATGCAGTTGTGGGACCGCAGTTTGGTC
CTGGGGACCATTCATACCCACACACCCAGCTTGTGCCTGTGGTTAACATCTCAGAAAACTCTGGTAAAT
GATCACTCCAGGATATTGACAAGAATACACGTTACTGATCTTACTCACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_015692.5
Synonyms ASGD8; K-CAP; VIP
Summary This gene encodes a member of the protease inhibitor I39 (alpha-2-macroglobulin) family of proteins. These proteins are important in innate and acquired immunity. The encoded protein is membrane-associated and proteolytically processed to generate two chains. Mutations in this gene cause a form of anterior segment dysgenesis, a developmental disorder of the eye. [provided by RefSeq, May 2017]
Locus ID 27151
MW 7.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...