SAP155 (SF3B1) (NM_001005526) Human 3' UTR Clone

CAT#: SC201636

3' UTR clone of splicing factor 3b subunit 1 155kDa (SF3B1) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name SAP155 (SF3B1) (NM_001005526) Human 3' UTR Clone
Vector pMirTarget
Synonyms Hsh155; MDS; PRP10; PRPF10; SAP155; SF3b155
ACCN NM_001005526
Insert Size 166 bp
Sequence Data
>SC201636 3’UTR clone of NM_001005526
The sequence shown below is from the reference sequence of NM_001005526. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTTGCAGATGGCTTCTATTCTGCTGCTTGAAGTCAGAACTGCTGATGGAGACAAAGGCACGAAAGTGTA
CGTATTCCGGATTAGCAACCCAGGAACCCATCACTTCTGAAGACTCTAAACTGTGCTGTCATTTTGTTT
TTATATGCATTAAAATATTTGTTTTAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001005526.2
Synonyms Hsh155; MDS; PRP10; PRPF10; SAP155; SF3b155
Summary This gene encodes subunit 1 of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. The carboxy-terminal two-thirds of subunit 1 have 22 non-identical, tandem HEAT repeats that form rod-like, helical structures. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Locus ID 23451
MW 6.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...