FXYD1 (NM_005031) Human 3' UTR Clone

CAT#: SC201619

3' UTR clone of FXYD domain containing ion transport regulator 1 (FXYD1) transcript variant a for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name FXYD1 (NM_005031) Human 3' UTR Clone
Vector pMirTarget
Synonyms PLM
ACCN NM_005031
Insert Size 252 bp
Sequence Data
>SC201619 3’UTR clone of NM_005031
The sequence shown below is from the reference sequence of NM_005031. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATCCGCCGTCTGTCCACCCGCAGGCGGTAGAAACACCTGGAGCGATGGAATCCGGCCAGGACTCCCCTG
GCACCTGACATCTCCCACGCTCCACCTGCGCGCCCACCGCCCCCTCCGCCGCCCCTTCCCCAGCCCTGC
CCCCGCAGACTCCCCCTGCCGCCAAGACTTCCAATAAAACGTGCGTTCCTCTCGACAGCACTTTGTCGG
TCTCGGTCCCTCAGCGCGAAACGCCAGCGCCACTGGGCCCCAGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005031.5
Synonyms PLM
Summary This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The approved human gene nomenclature for the family is FXYD-domain containing ion transport regulator. Mouse FXYD5 has been termed RIC (Related to Ion Channel). FXYD2, also known as the gamma subunit of the Na,K-ATPase, regulates the properties of that enzyme. FXYD1 (phospholemman), FXYD2 (gamma), FXYD3 (MAT-8), FXYD4 (CHIF), and FXYD5 (RIC) have been shown to induce channel activity in experimental expression systems. Transmembrane topology has been established for two family members (FXYD1 and FXYD2), with the N-terminus extracellular and the C-terminus on the cytoplasmic side of the membrane. The protein encoded by this gene is a plasma membrane substrate for several kinases, including protein kinase A, protein kinase C, NIMA kinase, and myotonic dystrophy kinase. It is thought to form an ion channel or regulate ion channel activity. Transcript variants with different 5' UTR sequences have been described in the literature. [provided by RefSeq, Jul 2008]
Locus ID 5348
MW 9.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...