BAF53b (ACTL6B) (NM_016188) Human 3' UTR Clone

CAT#: SC201603

3' UTR clone of actin-like 6B (ACTL6B) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name BAF53b (ACTL6B) (NM_016188) Human 3' UTR Clone
Vector pMirTarget
Synonyms ACTL6; arpNalpha; BAF53B; DEE76; EIEE76; IDDSSAD
ACCN NM_016188
Insert Size 179 bp
Sequence Data
>SC201603 3’UTR clone of NM_016188
The sequence shown below is from the reference sequence of NM_016188. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGCAGTGCGTGGAGCGAAAGTGCCCCTGATGGCACTCCTCCCCACACACCTGCTCCCAAGCTCAGATG
GAAGTCCCTTAACCCCCATGCCACATTGCCCCCCTCCTCCTTTCCCTCTTGTCCTCATTAATGGTGATG
TTTCTGGGTTGAAAGAAGTAAAAATGTTTTAAGAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_016188.5
Synonyms ACTL6; arpNalpha; BAF53B; DEE76; EIEE76; IDDSSAD
Summary The protein encoded by this gene is a member of a family of actin-related proteins (ARPs) which share significant amino acid sequence identity to conventional actins. Both actins and ARPs have an actin fold, which is an ATP-binding cleft, as a common feature. The ARPs are involved in diverse cellular processes, including vesicular transport, spindle orientation, nuclear migration and chromatin remodeling. This gene encodes a subunit of the BAF (BRG1/brm-associated factor) complex in mammals, which is functionally related to SWI/SNF complex in S. cerevisiae and Drosophila; the latter is thought to facilitate transcriptional activation of specific genes by antagonizing chromatin-mediated transcriptional repression. This subunit may be involved in the regulation of genes by structural modulation of their chromatin, specifically in the brain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Locus ID 51412
MW 6.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...