COMP (NM_000095) Human 3' UTR Clone

CAT#: SC201594

3' UTR clone of cartilage oligomeric matrix protein (COMP) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name COMP (NM_000095) Human 3' UTR Clone
Vector pMirTarget
Synonyms CTS2; EDM1; EPD1; MED; PSACH; THBS5; TSP5
ACCN NM_000095
Insert Size 172 bp
Sequence Data
>SC201594 3’UTR clone of NM_000095
The sequence shown below is from the reference sequence of NM_000095. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TATGAGACCCATCAGCTGCGGCAAGCCTAGGGACCAGGGTGAGGACCCGCCGGATGACAGCCACCCTCA
CCGCGGCTGGATGGGGGCTCTGCACCCAGCCCCAAGGGGTGGCCGTCCTGAGGGGGAAGTGAGAAGGGC
TCAGAGAGGACAAAATAAAGTGTGTGTGCAGGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000095.3
Synonyms CTS2; EDM1; EPD1; MED; PSACH; THBS5; TSP5
Summary The protein encoded by this gene is a noncollagenous extracellular matrix (ECM) protein. It consists of five identical glycoprotein subunits, each with EGF-like and calcium-binding (thrombospondin-like) domains. Oligomerization results from formation of a five-stranded coiled coil and disulfides. Binding to other ECM proteins such as collagen appears to depend on divalent cations. Contraction or expansion of a 5 aa aspartate repeat and other mutations can cause pseudochondroplasia (PSACH) and multiple epiphyseal dysplasia (MED). [provided by RefSeq, Jul 2016]
Locus ID 1311
MW 5.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...