ZCWPW1 (NM_017984) Human 3' UTR Clone

CAT#: SC201582

3' UTR clone of zinc finger CW type with PWWP domain 1 (ZCWPW1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name ZCWPW1 (NM_017984) Human 3' UTR Clone
Vector pMirTarget
Synonyms ZCW1
ACCN NM_017984
Insert Size 172 bp
Sequence Data
>SC201582 3’UTR clone of NM_017984
The sequence shown below is from the reference sequence of NM_017984. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACTTCCCCGTGGCGCTGTTTGGGAAGTAGCTGGTGCTCCTCTGCTCCCTCTTTTTCTCCCTTCTCTGG
GGCGCAGGAGGGAGAAGTTGCTAAGTGCTGGGTCTGTTCATTGGCTATGAGGTTCAAATGTGTGTGGTG
CAGTTTCTGTGTTAATAAAGCAGGTTACAGTCGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_017984.6
Synonyms ZCW1
Summary Dual histone methylation reader specific for PRDM9-catalyzed histone marks (H3K4me3 and H3K36me3) (PubMed:32744506, PubMed:20826339). Facilitates the repair of PRDM9-induced meiotic double-strand breaks (DSBs) (By similarity). Essential for male fertility and spermatogenesis (By similarity). Required for meiosis prophase I progression in male but not in female germ cells (By similarity).[UniProtKB/Swiss-Prot Function]
Locus ID 55063
MW 6.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...