SAP62 (SF3A2) (NM_007165) Human 3' UTR Clone

CAT#: SC201581

3' UTR clone of splicing factor 3a subunit 2 66kDa (SF3A2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name SAP62 (SF3A2) (NM_007165) Human 3' UTR Clone
Vector pMirTarget
Synonyms PRP11; PRPF11; SAP62; SF3a66
ACCN NM_007165
Insert Size 139 bp
Sequence Data
>SC201581 3’UTR clone of NM_007165
The sequence shown below is from the reference sequence of NM_007165. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AACATACCTCCCCCTCCCCCAACCAACTGAGAAGCTGCTCCCTCCCCCAGCAAGCCCAGCGCCAGGTGC
TCTTGCCTTTTCCCACTGAGAGAAGGCTGCTCTTTTGTACTGCCCCCCGCTCATTAAACAGCCTCCCCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_007165.5
Synonyms PRP11; PRPF11; SAP62; SF3a66
Summary This gene encodes subunit 2 of the splicing factor 3a protein complex. The splicing factor 3a heterotrimer includes subunits 1, 2 and 3 and is necessary for the in vitro conversion of 15S U2 snRNP into an active 17S particle that performs pre-mRNA splicing. Subunit 2 interacts with subunit 1 through its amino-terminus while the single zinc finger domain of subunit 2 plays a role in its binding to the 15S U2 snRNP. Subunit 2 may also function independently of its RNA splicing function as a microtubule-binding protein. [provided by RefSeq, Jul 2008]
Locus ID 8175
MW 4.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...