CIAO2B (NM_016062) Human 3' UTR Clone

CAT#: SC201578

3' UTR clone of family with sequence similarity 96 member B (FAM96B) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name CIAO2B (NM_016062) Human 3' UTR Clone
Vector pMirTarget
Synonyms CGI-128; CIA2B; FAM96B; MIP18
ACCN NM_016062
Insert Size 168 bp
Sequence Data
>SC201578 3’UTR clone of NM_016062
The sequence shown below is from the reference sequence of NM_016062. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTGAATCAGTGCCTGTCAGCCCGCTCCTGAGCCTGGCCTTTGACCCCTCAGCCTGCATACTGGTATCCT
GGTCCCAGCTCCTGCCAGGGCTGTTACCGTTGTTTTCTTGAATCACTCACAATGAGAAACTAACATTTT
GCTTTTTGTAATAAAGTTAATTTATATTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_016062.4
Synonyms CGI-128; CIA2B; FAM96B; MIP18
Summary Component of the cytosolic iron-sulfur protein assembly (CIA) complex, a multiprotein complex that mediates the incorporation of iron-sulfur cluster into extramitochondrial Fe/S proteins (PubMed:23891004, PubMed:22678362, PubMed:22678361). As a CIA complex component and in collaboration with CIAO1 and MMS19, binds to and facilitates the assembly of most cytosolic-nuclear Fe/S proteins (PubMed:23891004). As part of the mitotic spindle-associated MMXD complex it plays a role in chromosome segregation, probably by facilitating iron-sulfur cluster assembly into ERCC2/XPD (PubMed:20797633).[UniProtKB/Swiss-Prot Function]
Locus ID 51647
MW 6.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...