MAGED2 (NM_014599) Human 3' UTR Clone

CAT#: SC201574

3' UTR clone of melanoma antigen family D 2 (MAGED2) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name MAGED2 (NM_014599) Human 3' UTR Clone
Vector pMirTarget
Synonyms 11B6; BARTS5; BCG-1; BCG1; HCA10; MAGE-D2
ACCN NM_014599
Insert Size 173 bp
Sequence Data
>SC201574 3’UTR clone of NM_014599
The sequence shown below is from the reference sequence of NM_014599. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCTGGTGCCTGTGGTTTCTCCTACAAGTGAGATTTTAGATATTGTTAATCCTGCCAGTCTTTCTCTTCA
AGCCAGGGTGCATCCTCAGAAACCTACTCAACACAGCACTCTAGGCAGCCACTATCAATCAATTGAAGT
TGACACTCTGCATTAAATCTATTTGCCATTTCTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_014599.6
Synonyms 11B6; BARTS5; BCG-1; BCG1; HCA10; MAGE-D2
Summary This gene is a member of the MAGED gene family. The MAGED genes are clustered on chromosome Xp11. This gene is located in Xp11.2, a hot spot for X-linked intellectual disability (XLID). Mutations in this gene cause a form of transient antenatal Bartter's syndrome. This gene may also be involved in several types of cancer, including breast cancer and melanoma. The protein encoded by this gene is progressively recruited from the cytoplasm to the nucleoplasm during the interphase and after nucleolar stress and is thus thought to play a role in cell cycle regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2017]
Locus ID 10916
MW 6.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...