MRPS24 (NM_032014) Human 3' UTR Clone

CAT#: SC201566

3' UTR clone of mitochondrial ribosomal protein S24 (MRPS24) nuclear gene encoding mitochondrial protein for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name MRPS24 (NM_032014) Human 3' UTR Clone
Vector pMirTarget
Synonyms bMRP-47; bMRP47; HSPC335; MRP-S24; S24mt
ACCN NM_032014
Insert Size 171 bp
Sequence Data
>SC201566 3’UTR clone of NM_032014
The sequence shown below is from the reference sequence of NM_032014. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCCTCAAAGGTTGTGTATAAGTACCTCTAGAACAATCCCCTTTTTTCCATCAAGCTGTAGCCTGCAGAG
AATGGAAACGTGGGAAAGGAATGGTATGTGGGGGAAATGCATCCCCTCAGAGGACTGAGGCATAGTCTC
TCATCTGCTATTGAATAAAGACCTTCTATCTTG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_032014.3
Synonyms bMRP-47; bMRP47; HSPC335; MRP-S24; S24mt
Summary Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. A pseudogene corresponding to this gene is found on chromosome 11. Read-through transcription exists between this gene and the upstream upregulator of cell proliferation (URGCP) gene. [provided by RefSeq, Mar 2011]
Locus ID 64951
MW 6.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...