CKLF (NM_001040138) Human 3' UTR Clone

CAT#: SC201565

3' UTR clone of chemokine-like factor (CKLF) transcript variant 5 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name CKLF (NM_001040138) Human 3' UTR Clone
Vector pMirTarget
Synonyms C32; CKLF1; CKLF2; CKLF3; CKLF4; HSPC224; UCK-1
ACCN NM_001040138
Insert Size 226 bp
Sequence Data
>SC201565 3’UTR clone of NM_001040138
The sequence shown below is from the reference sequence of NM_001040138. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACATTGACAGTTGGTGGAGGGTTATTTTAACTCAGTATAGGAGCTAGAGGAAGAGATTTCCGAAGTCTG
CACCCCGCGCAGAGCACTACTGTAACTTCCAAGGGAGCGCTGGGAGCAGCGGGATCGGGTTTTCCGGCA
CCCGGGCCTGGGTGGCAGGGAAGAATGTGCCGGGATCCGCCTCAGGGATCTTTGAATCTCTTTACTGCC
TGGCTGGCCGGCAGCTCCG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001040138.3
Synonyms C32; CKLF1; CKLF2; CKLF3; CKLF4; HSPC224; UCK-1
Summary The product of this gene is a cytokine. Cytokines are small proteins that have an essential role in the immune and inflammatory responses. This gene is one of several chemokine-like factor genes located in a cluster on chromosome 16. The protein encoded by this gene is a potent chemoattractant for neutrophils, monocytes and lymphocytes. It also can stimulate the proliferation of skeletal muscle cells. This protein may play important roles in inflammation and in the regeneration of skeletal muscle. Alternatively spliced transcript variants encoding different isoforms have been identified. Naturally occurring read-through transcription occurs between this locus and the neighboring locus CMTM1 (CKLF-like MARVEL transmembrane domain containing 1).[provided by RefSeq, Feb 2011]
Locus ID 51192
MW 7.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...