Cytokeratin 16 (KRT16) (NM_005557) Human 3' UTR Clone

CAT#: SC201550

3' UTR clone of keratin 16 (KRT16) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Cytokeratin 16 (KRT16) (NM_005557) Human 3' UTR Clone
Vector pMirTarget
Synonyms CK16; FNEPPK; K1CP; K16; KRT16A; NEPPK; PC1
ACCN NM_005557
Insert Size 187 bp
Sequence Data
>SC201550 3’UTR clone of NM_005557
The sequence shown below is from the reference sequence of NM_005557. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCCAGCTTCAGCCAGGGCCAGAGCTCCTAGAACTGAGCTGCCTCTACCACAGCCTCCTGCCCACCAGCT
GGCCTCACCTCCTGAAGGCCCGGGTCAGGACCCTGCTCTCCTGGCGCAGTTCCCAGCTATCTCCCCTGC
TCCTCTGCTGGTGGTGGGCTAATAAAGCTGACTTTCTGGTTGATGCAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005557.4
Synonyms CK16; FNEPPK; K1CP; K16; KRT16A; NEPPK; PC1
Summary The protein encoded by this gene is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains and are clustered in a region of chromosome 17q12-q21. This keratin has been coexpressed with keratin 14 in a number of epithelial tissues, including esophagus, tongue, and hair follicles. Mutations in this gene are associated with type 1 pachyonychia congenita, non-epidermolytic palmoplantar keratoderma and unilateral palmoplantar verrucous nevus. [provided by RefSeq, Jul 2008]
Locus ID 3868
MW 6.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...