PRAM1 (NM_032152) Human 3' UTR Clone

CAT#: SC201548

3' UTR clone of PML-RARA regulated adaptor molecule 1 (PRAM1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name PRAM1 (NM_032152) Human 3' UTR Clone
Vector pMirTarget
Synonyms PML-RAR; PRAM-1
ACCN NM_032152
Insert Size 163 bp
Sequence Data
>SC201548 3’UTR clone of NM_032152
The sequence shown below is from the reference sequence of NM_032152. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAAAACCAACCACTCCCCCTGGGACGGTAAGACCGGTAGGCGTGGGGCCAGGACAGCCAGCCAGCCCAG
CGCCCGCTCACCCAGGAGCCCTGGATCCCGGCGCGGGAAAGTCACAGAGCTGCCTGGGCTTGTACCTGG
CCACATAAAGCCCCAGTTTAAAGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_032152.5
Synonyms PML-RAR; PRAM-1
Summary The protein encoded by this gene is similar to FYN binding protein (FYB/SLAP-130), an adaptor protein involved in T cell receptor mediated signaling. This gene is expressed and regulated during normal myelopoiesis. The expression of this gene is induced by retinoic acid and is inhibited by the expression of PML-RARalpha, a fusion protein of promyelocytic leukemia (PML) and the retinoic acid receptor-alpha (RARalpha). [provided by RefSeq, Jul 2008]
Locus ID 84106
MW 6.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...