PTGR1 (NM_012212) Human 3' UTR Clone

CAT#: SC201489

3' UTR clone of prostaglandin reductase 1 (PTGR1) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name PTGR1 (NM_012212) Human 3' UTR Clone
Vector pMirTarget
Synonyms DIG-1; LTB4DH; PGR1; ZADH3
ACCN NM_012212
Insert Size 186 bp
Sequence Data
>SC201489 3’UTR clone of NM_012212
The sequence shown below is from the reference sequence of NM_012212. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AATTTGGGGAAGACAATAGTGAAAGCATGAAAAAGAGGACACATGGAATCTGGAGGCCATTTAGATGAT
TAGTTAATTTGTTTTTCACCATTTAGCAAAAATGTATACTACCTTAAATGTCTTAAGAAATAGTACTCA
TAATGAGTTTGAGCTACTTAATAAAATACATTTAAGTGGTATGTAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_012212.3
Synonyms DIG-1; LTB4DH; PGR1; ZADH3
Summary This gene encodes an enzyme that is involved in the inactivation of the chemotactic factor, leukotriene B4. The encoded protein specifically catalyzes the NADP+ dependent conversion of leukotriene B4 to 12-oxo-leukotriene B4. A pseudogene of this gene is found on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
Locus ID 22949
MW 7.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...