LXR alpha (NR1H3) (NM_005693) Human 3' UTR Clone

CAT#: SC201479

3' UTR clone of nuclear receptor subfamily 1 group H member 3 (NR1H3) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name LXR alpha (NR1H3) (NM_005693) Human 3' UTR Clone
Vector pMirTarget
Synonyms LXR-a; LXRA; RLD-1
ACCN NM_005693
Insert Size 367 bp
Sequence Data
>SC201479 3’UTR clone of NM_005693
The sequence shown below is from the reference sequence of NM_005693. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTCTCTGAGATCTGGGATGTGCACGAATGACTGTTCTGTCCCCATATTTTCTGTTTTCTTGGCCGGATG
GCTGAGGCCTGGTGGCTGCCTCCTAGAAGTGGAACAGACTGAGAAGGGCAAACATTCCTGGGAGCTGGG
CAAGGAGATCCTCCCGTGGCATTAAAAGAGAGTCAAAGGGTTGCGAGTTTTGTGGCTACTGAGCAGTGG
AGCCCTCGCTAACACTGTGCTGTGTCTGAAGATCATGCTGACCCCACAAACGGATGGGCCTGGGGGCCA
CTTTGCACAGGGTTCTCCAGAGCCCTGCCCATCCTGCCTCCACCACTTCCTGTTTTTCCCACAGGGCCC
CAAGAAAAATTCTCCACTGTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005693.4
Synonyms LXR-a; LXRA; RLD-1
Summary The protein encoded by this gene belongs to the NR1 subfamily of the nuclear receptor superfamily. The NR1 family members are key regulators of macrophage function, controlling transcriptional programs involved in lipid homeostasis and inflammation. This protein is highly expressed in visceral organs, including liver, kidney and intestine. It forms a heterodimer with retinoid X receptor (RXR), and regulates expression of target genes containing retinoid response elements. Studies in mice lacking this gene suggest that it may play an important role in the regulation of cholesterol homeostasis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Locus ID 10062
MW 13.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...