PMP70 (ABCD3) (NM_001122674) Human 3' UTR Clone

CAT#: SC201473

3' UTR clone of ATP-binding cassette sub-family D (ALD) member 3 (ABCD3) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name PMP70 (ABCD3) (NM_001122674) Human 3' UTR Clone
Vector pMirTarget
Synonyms ABC43; CBAS5; PMP70; PXMP1; ZWS2
ACCN NM_001122674
Insert Size 203 bp
Sequence Data
>SC201473 3’UTR clone of NM_001122674
The sequence shown below is from the reference sequence of NM_001122674. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGGTACTTGGAAAAATTTTGTGGCATTAAAAACCAGACAAATGTATTGGCCAGGCGTGGTGGCTCATG
CCTGTAATCCCAGCACTTTGGGAGGCTGAGATGGGAGGATCGCTTGAATCCAGGAGTTCGAGACAAGCC
TGGACAAAAAGCGAGACCCGCTTCTTTAAAAAATAATAATAAAACAGAAGTTCTTAAACCATGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001122674.2
Synonyms ABC43; CBAS5; PMP70; PXMP1; ZWS2
Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ALD subfamily, which is involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle. All known peroxisomal ABC transporters are half transporters which require a partner half transporter molecule to form a functional homodimeric or heterodimeric transporter. This peroxisomal membrane protein likely plays an important role in peroxisome biogenesis. Mutations have been associated with some forms of Zellweger syndrome, a heterogeneous group of peroxisome assembly disorders. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Locus ID 5825
MW 7.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...