PSMG1 (NM_203433) Human 3' UTR Clone

CAT#: SC201404

3' UTR clone of proteasome (prosome macropain) assembly chaperone 1 (PSMG1) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name PSMG1 (NM_203433) Human 3' UTR Clone
Vector pMirTarget
Synonyms C21LRP; DSCR2; LRPC21; PAC-1; PAC1
ACCN NM_203433
Insert Size 174 bp
Sequence Data
>SC201404 3’UTR clone of NM_203433
The sequence shown below is from the reference sequence of NM_203433. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AATGAGATTCAGAGTAACATTTATACATGATCTTAAACATTGTTTTGTAGTGTATATTACTTGTCCATT
CCTTTAAGGGGAGCAGCCTGCACTCTTTTGTAGATTACTTTTGGGGGATATATTTTGAGAATGATGAAA
CGGAATAAAATTGTAAAAAATTAATTGTAGTTTTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_203433.2
Synonyms C21LRP; DSCR2; LRPC21; PAC-1; PAC1
Summary Chaperone protein which promotes assembly of the 20S proteasome as part of a heterodimer with PSMG2. The PSMG1-PSMG2 heterodimer binds to the PSMA5 and PSMA7 proteasome subunits, promotes assembly of the proteasome alpha subunits into the heteroheptameric alpha ring and prevents alpha ring dimerization.[UniProtKB/Swiss-Prot Function]
Locus ID 8624
MW 6.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...