RC3H2 (NM_018835) Human 3' UTR Clone

CAT#: SC201330

3' UTR clone of ring finger and CCCH-type zinc finger domains 2 (RC3H2) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name RC3H2 (NM_018835) Human 3' UTR Clone
Vector pMirTarget
Synonyms MNAB; RNF164
ACCN NM_018835
Insert Size 110 bp
Sequence Data
>SC201330 3’UTR clone of NM_018835
The sequence shown below is from the reference sequence of NM_018835. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCTGCTGCATCTTGGTTATACCATTACTGAGTGCATTTTGGTGTGCCTATCTCTGATGGATGATTGATT
GCTTTTAAAACTTATAACAGAAATAAAATTGTAATCCCAGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_018835.5
Synonyms MNAB; RNF164
Summary Post-transcriptional repressor of mRNAs containing a conserved stem loop motif, called constitutive decay element (CDE), which is often located in the 3' UTR, as in HMGXB3, ICOS, IER3, NFKBID, NFKBIZ, PPP1R10, TNF and in many more mRNAs. Binds to CDE and promotes mRNA deadenylation and degradation. This process does not involve miRNAs. In follicular helper T (Tfh) cells, represses of ICOS and TNFRSF4 expression, thus preventing spontaneous Tfh cell differentiation, germinal center B-cell differentiation in the absence of immunization and autoimmunity. In resting or LPS-stimulated macrophages, controls inflammation by suppressing TNF expression. Also recognizes CDE in its own mRNA and in that of paralogous RC3H1, possibly leading to feedback loop regulation (By similarity). miRNA-binding protein that regulates microRNA homeostasis. Enhances DICER-mediated processing of pre-MIR146a but reduces mature MIR146a levels through an increase of 3' end uridylation. Both inhibits ICOS mRNA expression and they may act together to exert the suppression (PubMed:25697406). Acts as a ubiquitin E3 ligase. Pairs with E2 enzymes UBE2B, UBE2D2, UBE2E2, UBE2E3, UBE2G2, UBE2K and UBE2Q2 and produces polyubiquitin chains (PubMed:26489670). Show the strongest activity when paired with UBE2N:UBE2V1 or UBE2N:UBE2V2 E2 complexes and generate both short and long polyubiquitin chains (PubMed:26489670). Involved in the ubiquitination of MAP3K5 (PubMed:24448648, PubMed:26489670) (By similarity). Able to interact with double-stranded RNA (dsRNA) (PubMed:26489670).[UniProtKB/Swiss-Prot Function]
Locus ID 54542
MW 4.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...