Cytokeratin 19 (KRT19) (NM_002276) Human 3' UTR Clone

CAT#: SC201326

3' UTR clone of keratin 19 (KRT19) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Cytokeratin 19 (KRT19) (NM_002276) Human 3' UTR Clone
Vector pMirTarget
Synonyms CK19; K1CS; K19
ACCN NM_002276
Insert Size 156 bp
Sequence Data
>SC201326 3’UTR clone of NM_002276
The sequence shown below is from the reference sequence of NM_002276. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AACAATTTGTCTGCCTCCAAGGTCCTCTGAGGCAGCAGGCTCTGGGGCTTCTGCTGTCCTTTGGAGGGT
GTCTTCTGGGTAGAGGGATGGGAAGGAAGGGACCCTTACCCCCGGCTCTTCTCCTGACCTGCCAATAAA
AATTTATGGTCCAAGGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002276.5
Synonyms CK19; K1CS; K19
Summary The protein encoded by this gene is a member of the keratin family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. The type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains. Unlike its related family members, this smallest known acidic cytokeratin is not paired with a basic cytokeratin in epithelial cells. It is specifically expressed in the periderm, the transiently superficial layer that envelopes the developing epidermis. The type I cytokeratins are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jul 2008]
Locus ID 3880
MW 5.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...