TBC1D17 (NM_024682) Human 3' UTR Clone

CAT#: SC201320

3' UTR clone of TBC1 domain family member 17 (TBC1D17) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name TBC1D17 (NM_024682) Human 3' UTR Clone
Vector pMirTarget
ACCN NM_024682
Insert Size 156 bp
Sequence Data
>SC201320 3’UTR clone of NM_024682
The sequence shown below is from the reference sequence of NM_024682. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGGAGGAGGACGAGGGCGCCGACTCCTAACCCCGCCAGGCAGCCTCGTTCTGCACAGGCACTTTAGCC
CGAGCCAGGCACACCTGCGAGGGGGCAGGTGTGCTCCGCCGCCCTGCTGATAAGCTGGCTTCATTAAAC
TGACACTTCTCATGTGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_024682.3
Summary Probable GTPase-activating protein for Rab8; its transient association with Rab8 is mediated by OPTN. Inhibits Rab8-mediated endocytic trafficking, such as of transferrin receptor (TfR) and reduces Rab8 recruitnment to tubules emanating from the endocytic recycling compartment (ERC). Involved in regulation of autophagy. Mediates inhibition of autophagy caused by the OPTN variant GLC1E LYS-50; the function requires its catalytic activity, however, the involved Rab is not known.[UniProtKB/Swiss-Prot Function]
Locus ID 79735
MW 5.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...