CTU2 (NM_001012759) Human 3' UTR Clone

CAT#: SC201304

3' UTR clone of cytosolic thiouridylase subunit 2 homolog (S. pombe) (CTU2) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name CTU2 (NM_001012759) Human 3' UTR Clone
Vector pMirTarget
Synonyms C16orf84; MFRG; NCS2; UPF0432
ACCN NM_001012759
Insert Size 175 bp
Sequence Data
>SC201304 3’UTR clone of NM_001012759
The sequence shown below is from the reference sequence of NM_001012759. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACAGTGACGACGAGGCGGGCCAGAGCTGAGCGTGAGGACGTGCTTGCCGGGACAGCAGGCAGTGGCCA
CCTGGTACACCACACTGGAGCCGGAAGGCAAGGACGGGGGACTGGCCTCTGATTGTCCATTTGTATAAA
TAAAACATTTTTTAATTAAAAAAAAAACTCTACAGTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001012759.3
Synonyms C16orf84; MFRG; NCS2; UPF0432
Summary This gene encodes a protein which is involved in the post-transcriptional modification of transfer RNAs (tRNAs). The encoded protein plays a role in thiolation of uridine residue present at the wobble position in a subset of tRNAs, resulting in enhanced codon reading accuracy. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
Locus ID 348180
MW 6.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...