GPSN2 (TECR) (NM_138501) Human 3' UTR Clone

CAT#: SC201300

3' UTR clone of trans-23-enoyl-CoA reductase (TECR) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name GPSN2 (TECR) (NM_138501) Human 3' UTR Clone
Vector pMirTarget
Synonyms GPSN2; MRT14; SC2; TER
ACCN NM_138501
Insert Size 139 bp
Sequence Data
>SC201300 3’UTR clone of NM_138501
The sequence shown below is from the reference sequence of NM_138501. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGCATGCCCATCATCCCCTTCCTGCTCTGAGCGCTCACCCCTGCTGAGGCTCAGCCCCTCAACCCGGTG
GCATTCTGGGGGAGGAGTGGGGCCCACAGCTCTCCAGCACCCGGAATAAAGCCCGCCTGCCCCAGTCGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_138501.6
Synonyms GPSN2; MRT14; SC2; TER
Summary This gene encodes a multi-pass membrane protein that resides in the endoplasmic reticulum, and belongs to the steroid 5-alpha reductase family. The elongation of microsomal long and very long chain fatty acid consists of 4 sequential reactions. This protein catalyzes the final step, reducing trans-2,3-enoyl-CoA to saturated acyl-CoA. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Apr 2011]
Locus ID 9524
MW 4.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...