PAR6 (PARD6A) (NM_001037281) Human 3' UTR Clone

CAT#: SC201252

3' UTR clone of par-6 partitioning defective 6 homolog alpha (C. elegans) (PARD6A) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name PAR6 (PARD6A) (NM_001037281) Human 3' UTR Clone
Vector pMirTarget
Synonyms PAR-6A; PAR6; PAR6alpha; PAR6C; TAX40; TIP-40
ACCN NM_001037281
Insert Size 157 bp
Sequence Data
>SC201252 3’UTR clone of NM_001037281
The sequence shown below is from the reference sequence of NM_001037281. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGAGGAGATGGTAGTGGCTTCAGCCTCTGACAGTCAGGATGAAGCCCCATGCCACTCCACACTGCTGGG
ACATGGCAGGGACTTCACAGTGGGGGTTTTTAGCTGGCTCACAGGGCTCCCTCAGCCTGGGGAACATTA
AAGGTTTTCTACAAATACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001037281.2
Synonyms PAR-6A; PAR6; PAR6alpha; PAR6C; TAX40; TIP-40
Summary This gene is a member of the PAR6 family and encodes a protein with a PSD95/Discs-large/ZO1 (PDZ) domain and a semi-Cdc42/Rac interactive binding (CRIB) domain. This cell membrane protein is involved in asymmetrical cell division and cell polarization processes as a member of a multi-protein complex. The protein also has a role in the epithelial-to-mesenchymal transition (EMT) that characterizes the invasive phenotype associated with metastatic carcinomas. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Locus ID 50855
MW 5.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...