MAGEC3 (NM_177456) Human 3' UTR Clone

CAT#: SC201221

3' UTR clone of melanoma antigen family C 3 (MAGEC3) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name MAGEC3 (NM_177456) Human 3' UTR Clone
Vector pMirTarget
Synonyms CT7.2; HCA2; MAGE-C3; MAGEC4
ACCN NM_177456
Insert Size 169 bp
Sequence Data
>SC201221 3’UTR clone of NM_177456
The sequence shown below is from the reference sequence of NM_177456. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTTATCCAAGCTATCCAGTATCATCCCTAGTGCCTTTCCATCCTGGTACATGGATGCTTTGAAAGATAT
GGAAGACAGAGCCCAGGCCATAATTGACACCACAGATGATGCTACTGCCATGGCCAGTGCAAGCCCCAG
TGTCATGTCCACCAACTTCTGTCCTGAGTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_177456.2
Synonyms CT7.2; HCA2; MAGE-C3; MAGEC4
Summary This gene is a member of the MAGEC gene family. The members of this family are not expressed in normal tissues, except for testis, and are expressed in tumors of various histological types. The MAGEC genes are clustered on chromosome Xq26-q27. Two transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 139081
MW 6.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...