EIF3D (NM_003753) Human 3' UTR Clone

CAT#: SC201199

3' UTR clone of eukaryotic translation initiation factor 3 subunit D (EIF3D) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name EIF3D (NM_003753) Human 3' UTR Clone
Vector pMirTarget
Synonyms eIF3-p66; eIF3-zeta; EIF3S7
ACCN NM_003753
Insert Size 162 bp
Sequence Data
>SC201199 3’UTR clone of NM_003753
The sequence shown below is from the reference sequence of NM_003753. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAAGAGGAAGAAGAAGAGGAAGAAACTTAAACCAGTGATGTGGAGCTGGAGTTTGTCCTTCCACCGAGA
CTACGAGGGCCTTTGATGCTTAGTGGAATGTGTGTCTAACTTGCTCTCTGACATTTAGCAGATGAAATA
AAATATATATCTGTTTAGTCTTTC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003753.4
Synonyms eIF3-p66; eIF3-zeta; EIF3S7
Summary Eukaryotic translation initiation factor-3 (eIF3), the largest of the eIFs, is a multiprotein complex composed of at least ten nonidentical subunits. The complex binds to the 40S ribosome and helps maintain the 40S and 60S ribosomal subunits in a dissociated state. It is also thought to play a role in the formation of the 40S initiation complex by interacting with the ternary complex of eIF2/GTP/methionyl-tRNA, and by promoting mRNA binding. The protein encoded by this gene is the major RNA binding subunit of the eIF3 complex. [provided by RefSeq, Jul 2008]
Locus ID 8664
MW 6.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...