C4orf14 (NOA1) (NM_032313) Human 3' UTR Clone

CAT#: SC201168

3' UTR clone of chromosome 4 open reading frame 14 (C4orf14) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name C4orf14 (NOA1) (NM_032313) Human 3' UTR Clone
Vector pMirTarget
Synonyms C4orf14; hAtNOS1; hNOA1; mAtNOS1; MTG3
ACCN NM_032313
Insert Size 130 bp
Sequence Data
>SC201168 3’UTR clone of NM_032313
The sequence shown below is from the reference sequence of NM_032313. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGGAAGAAGAAAGGAAAGATAAATGTATGAGACCGACCTTGTTCACTCCAGATATTAACTGTATTGAAC
ACAACAAAATACATTGAATTTGTATTAAACATATAACGCATAAATAAAGCTCCCATTCTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_032313.4
Synonyms C4orf14; hAtNOS1; hNOA1; mAtNOS1; MTG3
Summary The protein encoded by this gene is a nuclear-encoded GTPase that functions in the mitochondrion. Upon translation, this protein is imported into the nucleus and then into the nucleolus before being exported to the mitochondrion. The encoded protein is required for oxygen-dependent regulation of mitochondrial respiratory complexes and for mitochondrial protein synthesis. [provided by RefSeq, Dec 2015]
Locus ID 84273
MW 5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...