SH2D2A (NM_001161444) Human 3' UTR Clone

CAT#: SC201160

3' UTR clone of SH2 domain protein 2A (SH2D2A) transcript variant 5 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name SH2D2A (NM_001161444) Human 3' UTR Clone
Vector pMirTarget
Synonyms F2771; SCAP; TSAD; VRAP
ACCN NM_001161444
Insert Size 151 bp
Sequence Data
>SC201160 3’UTR clone of NM_001161444
The sequence shown below is from the reference sequence of NM_001161444. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCATGGCTTCCCCTTGGGCCTCCTCAGTAGGCGGTAAGTCTGAGCTTGGTGAGGATAACTTGGAGCATC
AGGTCCAGAGACCTTCACACACACCTGGCACACTTCTCAAGAAATGTGGATGGAATAAACCATAGGTGT
TCAAAGCTGGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001161444.2
Synonyms F2771; SCAP; TSAD; VRAP
Summary This gene encodes an adaptor protein thought to function in T-cell signal transduction. A related protein in mouse is responsible for the activation of lymphocyte-specific protein-tyrosine kinase and functions in downstream signaling. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
Locus ID 9047
MW 5.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...