ARS2 (SRRT) (NM_001128854) Human 3' UTR Clone

CAT#: SC201142

3' UTR clone of serrate RNA effector molecule homolog (Arabidopsis) (SRRT) transcript variant 5 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name ARS2 (SRRT) (NM_001128854) Human 3' UTR Clone
Vector pMirTarget
Synonyms ARS2; ASR2; serrate
ACCN NM_001128854
Insert Size 145 bp
Sequence Data
>SC201142 3’UTR clone of NM_001128854
The sequence shown below is from the reference sequence of NM_001128854. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GATGCCCCAGACGATGTTGATTTCTTTTGAGCCGTCCCCCGTTCCTCAGTCCTGTATCATCCATACTTG
TACTACCTTGTCCTATGAAGCTCTGAGAATTTTTTGTACGATCAGCCTTACTGCTAATAAAAGCACTTC
CACAGGG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001128854.2
Synonyms ARS2; ASR2; serrate
Summary Acts as a mediator between the cap-binding complex (CBC) and the primary microRNAs (miRNAs) processing machinery during cell proliferation. Contributes to the stability and delivery of capped primary miRNA transcripts to the primary miRNA processing complex containing DGCR8 and DROSHA, thereby playing a role in RNA-mediated gene silencing (RNAi) by miRNAs. Binds capped RNAs (m7GpppG-capped RNA); however interaction is probably mediated via its interaction with NCBP1/CBP80 component of the CBC complex. Involved in cell cycle progression at S phase. Does not directly confer arsenite resistance but rather modulates arsenic sensitivity. Independently of its activity on miRNAs, necessary and sufficient to promote neural stem cell self-renewal. Does so by directly binding SOX2 promoter and positively regulating its transcription (By similarity).[UniProtKB/Swiss-Prot Function]
Locus ID 51593
MW 5.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...