HEXB (NM_000521) Human 3' UTR Clone

CAT#: SC201097

3' UTR clone of hexosaminidase B (beta polypeptide) (HEXB) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name HEXB (NM_000521) Human 3' UTR Clone
Vector pMirTarget
Synonyms ENC-1AS; HEL-248; HEL-S-111
ACCN NM_000521
Insert Size 143 bp
Sequence Data
>SC201097 3’UTR clone of NM_000521
The sequence shown below is from the reference sequence of NM_000521. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCTGGATATTGTAACCATGAGAACATGTAAAAAATGGAGGGGAAAAAGGCCACAGCAATCTGTACTACA
ATCAACTTTATTTTGAAATCATGTAAAATAAGATATTAGACTGTTTTTTGAATAAAATATTTTTATTGA
TTGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000521.4
Synonyms ENC-1AS; HEL-248; HEL-S-111
Summary Hexosaminidase B is the beta subunit of the lysosomal enzyme beta-hexosaminidase that, together with the cofactor GM2 activator protein, catalyzes the degradation of the ganglioside GM2, and other molecules containing terminal N-acetyl hexosamines. Beta-hexosaminidase is composed of two subunits, alpha and beta, which are encoded by separate genes. Both beta-hexosaminidase alpha and beta subunits are members of family 20 of glycosyl hydrolases. Mutations in the alpha or beta subunit genes lead to an accumulation of GM2 ganglioside in neurons and neurodegenerative disorders termed the GM2 gangliosidoses. Beta subunit gene mutations lead to Sandhoff disease (GM2-gangliosidosis type II). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
Locus ID 3074
MW 5.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...