MICAL3 (NM_001122731) Human 3' UTR Clone

CAT#: SC201058

3' UTR clone of microtubule associated monoxygenase calponin and LIM domain containing 3 (MICAL3) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name MICAL3 (NM_001122731) Human 3' UTR Clone
Vector pMirTarget
Synonyms MICAL-3
ACCN NM_001122731
Insert Size 160 bp
Sequence Data
>SC201058 3’UTR clone of NM_001122731
The sequence shown below is from the reference sequence of NM_001122731. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCTCCCACAGTGCTGGGATCACAGATGTGAGCTACTGGGCCCAGCTGAGCATAAGAGTCTTTTCTGTGT
CACCTTTGTGTTCCCTACAGTGTCTAGCAAGTGCGTTGTGAGGGGAAGATAATTGAATAAATTTTATCC
AGGTAAAAAAAAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001122731.2
Synonyms MICAL-3
Summary Monooxygenase that promotes depolymerization of F-actin by mediating oxidation of specific methionine residues on actin to form methionine-sulfoxide, resulting in actin filament disassembly and preventing repolymerization. In the absence of actin, it also functions as a NADPH oxidase producing H(2)O(2). Seems to act as Rab effector protein and plays a role in vesicle trafficking. Involved in exocytic vesicles tethering and fusion: the monooxygenase activity is required for this process and implicates RAB8A associated with exocytotic vesicles. Required for cytokinesis. Contributes to stabilization and/or maturation of the intercellular bridge independently of its monooxygenase activity. Promotes recruitment of Rab8 and ERC1 to the intercellular bridge, and together these proteins are proposed to function in timely abscission.[UniProtKB/Swiss-Prot Function]
Locus ID 57553
MW 5.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...