CD63 (NM_001780) Human 3' UTR Clone

CAT#: SC201054

3' UTR clone of CD63 molecule (CD63) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name CD63 (NM_001780) Human 3' UTR Clone
Vector pMirTarget
Synonyms LAMP-3; ME491; MLA1; OMA81H; TSPAN30
ACCN NM_001780
Insert Size 268 bp
Sequence Data
>SC201054 3’UTR clone of NM_001780
The sequence shown below is from the reference sequence of NM_001780. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGTATCAGAAGTGGCTACGAGGTGATGTAGGGGTCTGGTCTCCTCAGCCTCCTCATCTGGGGGAGTGGA
ATAGTATCCTCCAGGTTTTTCAATTAAACGGATTATTTTTTCAGACCGAAAAGAGATGGTCTGAGTTTG
TCTTAGAGTGATGCTTGATTCCTTCCTTTCCTTACTGATGTTCCCTGTCCTCTGGGACCTTAATGCATG
TGTACTTCGAGGTCTATTTTGGGGGGTGTTTGGGAAAGGAGGACTTTGCGAAGGTGTTGGT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001780.6
Synonyms LAMP-3; ME491; MLA1; OMA81H; TSPAN30
Summary The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. The encoded protein is a cell surface glycoprotein that is known to complex with integrins. It may function as a blood platelet activation marker. Deficiency of this protein is associated with Hermansky-Pudlak syndrome. Also this gene has been associated with tumor progression. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Apr 2012]
Locus ID 967
MW 10
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...